Sentence examples for system cell lines from inspiring English sources

To confirm these results in a more physiological system, cell lines stably over-expressing a low level of myc-tagged raptor alleles with stable knockdown of endogenous raptor with short hairpin RNA that targets the 3' UTR of raptor [16] were generated in Hela cells.

Channel interactions are detected in multi-target toxicity screens, and hERG IC50 values are generally established from automated patch-clamp experiments on expression system cell lines.

shRNA constructs were cloned into Open Biosystems/ThermoFisher, Huntsville, AL) lentiviral inducible system; cell lines generated using non-silencing and shRNA-598 (agagagacactctccatgaaca) were evaluated for both C35 and Her2 expression.

IC-50 (half maximal inhibitory concentration) value for fermenticin HV6b against each cell line is calculated which indicates how much bacteriocin is needed to inhibit the biological system (cell lines) by half [ 26].

For example, from the cell lineage tree we would predict that the determination of nervous system cell fate in several of the comparatively late restricting nervous system cell lines such as a8.17/ and17 a8.19/.19/ a8.19 (descendants of a4.2/ a4.2) depend on regional factor signaling whereas this might not be the case for A7.4/ A7.4 (descendants of A4.1/ A4.1/.

In the new work, Mignot, Stanford immunologist Elizabeth Mellins, and colleagues developed an immune system cell line that carries the HLA type associated with narcolepsy.

The eIF4E-inducible NIH 3T3 (3T3-tTA-eIF4E TET OFF system) cell line was previously described [27].

To determine if the attenuation of CYP3A gene expression predicted by the in silico model occurs in reality we next reproduced the in silico experiments in an in vitro setting: In addition, all components of the in vitro test system (cell line, target gene and PXR regulatory regions) were of human origin, allowing us to examine if the regulatory loop also functioned in the human context.

The data in the HEK293T cells was consistent with findings by other groups using other reporter systems, cell lines and/or transfection methods.

This can only be studied properly by employing more complex experimental systems; cell lines have shown themselves to be robust models of cell intrinsic processes.

The observation that the mechanisms underlying MOPr desensitization change with neuronal development is important when extrapolating to the mature brain results obtained from experiments on expression systems, cell lines and immature neuronal preparations.