Sentence examples for synthetic forward from inspiring English sources

OG and OF represent the greater and lesser singular values Fig. 2 Resistivity model used for the 3D synthetic forward modelling study.

These advances create an opportunity to move synthetic biology forward by making use of a level of regulation that is of yet unexplored.

Reverse transcription polymerase chain reaction on total RNA was performed using primers specific for the minigene only as a control of RT, for the synthetic exon (forward primer), and for the human Tim44 cDNA (reverse primer).

The coding sequence of the T. gondii GRA4 gene [GenBank: AAA30142.1] was amplified from the T. gondii genomic DNA, with a pair of specific synthetic primers (forward primer: 5′- CGGGGTACCATGCAGGGCACTTGGTTTTC -3′, reverse primer: 5′- CGCGGGATCCTCACTCTTTGCGCATTCTTT -3′), in which KpnI and BamHI restriction sites were introduced.

Experiments on realistic and synthetic IP forwarding tables show that the trie merging scheme reduces the number of nodes by up to 109.2 times as well as the memory consumption by up to 11.8 times compared to previous schemes.

The chapter also illustrates concepts like synthetic, cash flows, forward contracts, currency forwards, synthetics and pricing, and uses many applications to explain these concepts.

Simulations were run both with experimental and synthetic data in forward and backward directions along the core samples.

Achiral unsymmetrical four-ring bent-core liquid crystals with strongly polar cyano and nitro moieties as substituents at one end and alkyloxy group (butyl to dodecyl) at the other end have been synthesized by a simple and straight forward synthetic method.

We used the same computational domain, grid interval, and time step as those we used in the forward synthetic tests.

A straight forward synthetic pathway was adopted to synthesize the target compounds 31 50 as depicted in Scheme 1.

Some uncertainties in velocity structures cause greater discrepancies in the forward synthetic waveforms compared to the observations in several areas.