There are repeated references to the importance of consumer appeal: the person who lands the gig must "define design strategies that synthesize technology innovation and consumer desires" and "ensure creative direction for design is consumer focused", which make it look like Motorola eventually wants to release a wearable device that's meant for the masses.
Our method relies on functional modeling to create a technology-independent description of what the system does, and uses a Functional Modeling Compiler (FMC) to synthesize technology-dependent solutions that can be directly used to perform architectural design space exploration using multi-disciplinary simulations in AMESim and Modelica.
She uses Yamaha Corporation's Vocaloid 2 and Vocaloid 3 singing synthesizing technologies.
The project documents PET use and related public health coverage in countries represented by INAHTA members and synthesizes technology assessments of PET conducted by INAHTA members and three private US organizations.
In addition, the sequence of primers of forward and reverse was designed and synthesized by Technology Gene Company as follows: F: 5′ATCCGTCACACCTGCTCT3′.
Among the 15 suggested sequences, the one had the least dissociation constant (K d) was chosen (35.6 ± 2.9 nM) and synthesized by Technology Gene company that its sequence is as follows: 5′ATCCGTCACACCTGCTCTATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGATGGTGTTGGCTCCCGTAT3′.
The main point of criticism on this rationale lies on the fact that it does not suffice to equip teachers with adequate knowledge to naturally synthesize their technology skills with teaching methods and their knowledge of their subject matter (Angeli & Valanides, 2005; Jang, 2008; Koehler, Mishra, & Yahya, 2007; Wilson, 2003).
Human Histone H3 (amino acids 1 15) peptides were synthesized (Biomer technology, Pleasanton, CA) with a Cysteine at the N terminus.
RNA was extracted (Qiagen kit), cDNA synthesized (Life technology), and hybridized to Affymetrix Gene 1.0 ST as previously described.
Synthesizing in ASIC technology the architecture with P = {45, 90, 180, 360} FUs aims at finding the one which produces better power consumption and area results, while simultaneously supporting the throughput requirements of the standard.
