Our method relies on functional modeling to create a technology-independent description of what the system does, and uses a Functional Modeling Compiler (FMC) to synthesize technology-dependent solutions that can be directly used to perform architectural design space exploration using multi-disciplinary simulations in AMESim and Modelica.
Biosynthesis of nanomaterials as a novel nanoparticle synthesizing technology attracts increasing attention.
The project documents PET use and related public health coverage in countries represented by INAHTA members and synthesizes technology assessments of PET conducted by INAHTA members and three private US organizations.
She uses Yamaha Corporation's Vocaloid 2 and Vocaloid 3 singing synthesizing technologies.
The main point of criticism on this rationale lies on the fact that it does not suffice to equip teachers with adequate knowledge to naturally synthesize their technology skills with teaching methods and their knowledge of their subject matter (Angeli & Valanides, 2005; Jang, 2008; Koehler, Mishra, & Yahya, 2007; Wilson, 2003).
In addition, the sequence of primers of forward and reverse was designed and synthesized by Technology Gene Company as follows: F: 5′ATCCGTCACACCTGCTCT3′.
Among the 15 suggested sequences, the one had the least dissociation constant (K d) was chosen (35.6 ± 2.9 nM) and synthesized by Technology Gene company that its sequence is as follows: 5′ATCCGTCACACCTGCTCTATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGATGGTGTTGGCTCCCGTAT3′.
Human Histone H3 (amino acids 1 15) peptides were synthesized (Biomer technology, Pleasanton, CA) with a Cysteine at the N terminus.
RNA was extracted (Qiagen kit), cDNA synthesized (Life technology), and hybridized to Affymetrix Gene 1.0 ST as previously described.
Universal 'all 10-mer' microarrays were synthesized (Agilent Technologies, AMADID # 015681) and converted to double-stranded DNA arrays by primer extension as described previously [20], [24].
