Sentence examples for synthesis table from inspiring English sources

The T7 promoter sequence 5′GGATCCTAATACGACTCACTATAGGA3′ was added in front of the forward and reverse PCR primers as required for subsequent dsRNA synthesis (Table 1).

Remarkable differences in the defense mechanism, associated with unique characteristics of Mgaloblishvili, were found in genes related to pathogen recognition, signaling and antimicrobial compound synthesis (Table S3D).

FD and N are given as the design goal (Table 1) and the actuation number synthesis (Table 2), respectively.

The correlation between SSS activity and amylose accumulation rate was not significant, probably because SSS is mainly involved in amylopectin synthesis (Table 3).

Increased content in mg/kg grapes was due to the less berry weight and not due to the increase of synthesis (Table 5B).

The concentration of anthocyanins per berry is not associated to berry growth albeit to the increase in their synthesis (Table 8B).

The studied variations in the loading regime of the explants suggest a certain threshold for the magnitude of loading (>10 % or > 1.2 MPa) and the frequency (>0.5 Hz) to stimulate increased proteoglycan synthesis (Table 1).

Only two of these varied the loading magnitude or frequency, which suggest the need of a certain threshold (>20 % strain and > 0.5 Hz) for increased proteoglycan synthesis (Table 1).

1. Pathogen elicits WRKY TFs (Fig. 6d); 2. WRKY TFs elicit amylase (Table 4); 3. Starch metabolite occurs (Table 4); 4. Shikimic acid pathway assumably occurs; 5. Phenylpropanoid synthesis (Table 4); 6. Lignin synthesis (Table 4, Additional file 7: Figure S5); 7. WRKY induces β-oxidase activity (Table 4); 8. Fatty acid is degraded (Table 4); 9. NADPH and acyl-CoA promote diterpenoid synthesis; 10.

All three serine palmitoyltransferase genes (Sptlc1 3) were increased, suggesting increased sphingosine formation for ceramide synthesis (Table 11).

Besides, gene loss events were found in other Lactobacillus species that had made them lose the capability of de novo lysine synthesis (Table 2).