The data include: gene symbol, number of unique guides for the corresponding gene, ranks of each guide, DNA sequence for each corresponding guide RNA, number of most enriched guides, enrichment score, p-value, FDR, and corrected FDR (q-value).
Val-Kill itself can also be seen as a symbol of the unique relationship between the Roosevelts.
In opinion articles and informal conversations, some nonreligious Israelis said that they liked the eight-day absence of hametz, and that it was a small but potent symbol of a unique collective identity.
"To deny future generations of south central Harlem this visible symbol of their unique pride, culture and history is not only unconscionable" Mr. Tait wrote, "but to quote Mr. Mayer again: 'The demolition of St. Thomas the Apostle Church would be a barbaric act, and no economic interest could excuse such wrongdoing".' Yesterday, all was quiet at the scaffold-shrouded church.
Patients who had undergone left (n = 16) or right (n = 18) temporal lobectomy for relief of intractable epilepsy and healthy controls (n = 13) were administered two paired-associate learning tasks assessing their learning and memory of pairs of abstract designs or pairs of symbols in unique locations.
It's true that a writing system that requires readers to know thousands of unique symbols and that does not contain reliable cues to their pronunciation seems, at first, especially challenging.
A variation on this theme is the use of "alphabet size" to access scale: it designates the number of unique symbols available for use in by the sequence.
For example, to extract the alphabet (attribute "abc") one could do > new usm('acggctgctatctgcgtacggtcgac').abc "acgt" The first pre-processing step is that of using, or extracting if not specified, the list of unique symbols used in the sequence - the alphabet.
"For Germans, the car is a unique symbol of identity," Professor Hagstotz said.
The great tuskers are an irreplaceable symbol of our continent's unique natural heritage.
Yet in the collective imagination he remains, for all his flaws, a unique symbol of pride.
