Sentence examples for super array from inspiring English sources

For cDNA synthesis the RT2 PCR array first strand kit was used according to the instruction of the manufacturer (Super Array Bioscience Corporation).

Alternatively, RT2 Profiler™ PCR arrays were used to monitor 84 mouse inflammatory cytokine and receptor genes with build in house hold genes (Super Array Bioscience Corporation, MD, USA).

Real-time PCR reactions were performed in a 50-µl mixture containing 2 µl of cDNA, 10 µl of SYBR Green (Super Array, Frederick, MD), and 5 µM of human PGC-1α primers (forward: tccttgcagcacaagaaaac and reverse: gtctgcttcgtcgtcaaaaa) and human GAPDH Primers (forward: caaggagtaagacccctgga and reverse: gggtctacatggcaactgtg) on a 7300 Real Time PCR system (Applied Biosystems, Foster City, CA).

Expression of cancer pathway genes was evaluated using Cancer Pathway Finder gene expression arrays (Super Array Inc., Frederick, MA, USA), in accordance with the manufacturer's instructions.

The membrane was washed accordingly and then the hybridization signals were detected using the CPD Star chemiluminescent detection kit (Super Array Inc .. Following this, the membrane was scanned with a Fluor S phosphorimager (Biorad, Hemel Hempstead, Hertfordshire, UK) and the scanned image was converted into digital data and analyzed using GEArray Analyzer software (Super Array Inc).

Tumour metastasis-specific gene expression profiles of lung tissues from WT and SK1−/− mice, which were injected with MB49 cells were compared with the Q-PCR based super array.

Gene silencing of CEACAM6 was performed with pre-designed SureSilencing™ CEACAM6-shRNA plasmids (Super Array-Bioscience Corporation) containing four pooled shRNA sequences to ensure an effective depletion of CEACAM6 in A549 cells.

To characterize the effects of CR (with and without IGF-1 infusion) in the microenvironment in which mammary tumors arise in mice, we ran Insulin-PCR Super arrays (SABiosciences, Frederick, MD) using mRNA extracted from the mammary fat pads of control, 30% CR, and 30% CR + IGF-1 mice.

Reference RNA (XpressRef Universal Total RNA) was obtained from Super-Array (Frederick, MD, USA).

Wnt signaling RT-PCR super-arrays (PAH-043A) were obtained from SABiosciences Frederickk, MD). 1 µg of total RNA was used for reverse transcription and the entire cDNA reaction was diluted and distributed amongst the 96 wells of the super-array plate.

Super-arrays were used to further examine the effects of miR-31 on Wnt signaling in SAEC and Calu-6 cells.