Exact(1)
Employing sequences from a candidate gene and the 1000 Genomes Project, Fridley et al. (2010) demonstrated the feasibility of imputing genetic variants based on a sequenced proportion of a study sample, and they suggested sequencing "the largest and most diverse" subset.
Similar(58)
2) The reviewer suggests sequencing sorted nuclei to identify full-length APP copy number changes or perhaps flanking sequences towards assessing mechanisms of CNV generation.
Despite the challenges, there are several proof-of-principle examples that suggest sequencing strategies will identify low frequency variants involved in common human traits.
In my suggested sequence starting with two passes and one diamond, West makes a Michaels Cue-Bid, showing at least 5-5 in the majors.
(The most frequently suggested sequence of events involves Harvey going out on his own, perhaps as a producer, while Bob stays to run Dimension, Miramax's profitable youth- and genre-movie offshoot, though recent reports that the Weinsteins' nemesis Michael Eisner will step down as head of Disney has made the speculations even wilder and murkier).
Both feature sets and their combinations yielded a very high accuracy, which is as good as the previously suggested sequence motif and k-mer based method.
Among the 15 suggested sequences, the one had the least dissociation constant (K d) was chosen (35.6 ± 2.9 nM) and synthesized by Technology Gene company that its sequence is as follows: 5′ATCCGTCACACCTGCTCTATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGATGGTGTTGGCTCCCGTAT3′.
Based on the observations gathered from the sequence space analysis we suggested sequence space-based coreceptor prediction methods.
Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae.
For postmenopausal women, there is a flow chart with the medications available free of charge through the SUS, and a suggested sequence for the use of these medications.
Current clinical recommendations suggest sequencing of the leptin gene in cases of extreme early childhood obesity preferably in the presence of undetectable to low serum leptin levels.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com