Sentence examples for suggested sequence from inspiring English sources

In my suggested sequence starting with two passes and one diamond, West makes a Michaels Cue-Bid, showing at least 5-5 in the majors.

(The most frequently suggested sequence of events involves Harvey going out on his own, perhaps as a producer, while Bob stays to run Dimension, Miramax's profitable youth- and genre-movie offshoot, though recent reports that the Weinsteins' nemesis Michael Eisner will step down as head of Disney has made the speculations even wilder and murkier).

Both feature sets and their combinations yielded a very high accuracy, which is as good as the previously suggested sequence motif and k-mer based method.

Based on the observations gathered from the sequence space analysis we suggested sequence space-based coreceptor prediction methods.

Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae.

For postmenopausal women, there is a flow chart with the medications available free of charge through the SUS, and a suggested sequence for the use of these medications.

Among the 15 suggested sequences, the one had the least dissociation constant (K d) was chosen (35.6 ± 2.9 nM) and synthesized by Technology Gene company that its sequence is as follows: 5′ATCCGTCACACCTGCTCTATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGATGGTGTTGGCTCCCGTAT3′.

Nevertheless, the presence of these loci in sequenced isolates that failed to amplify suggests sequence divergence rather than loss of these loci by members of this population.

Exogenous delivery of phosphorothioate AS ODNs between 0.01 and 0.5 μM significantly inhibited parasite growth compared with sense sequence controls suggesting sequence specific inhibition.

Comparison of this approach to similar studies using larger sequence databases and/or different selection criteria suggests sequence database design can increase the success rate for identifying residue sites worth optimizing.

This suggests sequence conservation or interlocus recombination driven by interaction with other molecules.