Sentence examples for successful injection from inspiring English sources
Our injection apparatus did not allow quantification of injected volume; successful injection was monitored by the clearing of ooplasm around the needle tip.
There was 1 documented case of failure to successfully re-inject a lesion (second metatarsal) following 1 successful injection, but even so, healing was observed.
emb-29 (g52ts ) young adults were injected with plasmids containing a dominant rol-6 (pRF4, a marker for successful injection), the guide RNA (50 ng/μL), and a rescue oligonucleotide (ATGGGTAGCGGCAATCAATGAGAATATACTTGTCATCAAATTCTTTTTCA GAGAGTCGGAAAAAGATGTCTCTCAATGTTT CGGC C GTGATTCTTCTGAAGCCTTTCGAGGATTCCTTTGCAACAGTTTTGAGGTGG, IDT Coralville, IA; 30 ng/μL).
He took part in medical experiments, performing the first successful injection of a substance into the bloodstream (of a dog).
An extremely small operational parameter window was found for successful injection processing.
Column tests demonstrated successful injection of the vegetable oil suspension into a porous medium.
A common trend of 5 10% incremental oil was observed for the successful injections.
Further analysis was carried out only on animals which received comparable, successful injections (>60% retinal detachment and minimal complications).
Successful injections were confirmed by immediate IVIS.
Successful injections required a mean volume of 3.0 ml of Onyx.
During these successful injections, Onyx could be smoothly pushed retrogradely through the lobules until a segmental portal vein was embolized up to its origin.
