Sentence examples for submitted to pcr from inspiring English sources

Exact(22)

Cyst pellets were stored and submitted to PCR and nested-PCR reactions with gdh and tpi primers.

One hundred nanograms of DNA was submitted to PCR (BioConcept) amplification with GoTaq PCR reagent kit (Promega) with primers listed in the Supplementary Materials and Methods.

As negative controls, we included: (1) RNA extracted from Staq cell culture, known to be MAGE-A3-negative; (2) water submitted to reverse transcriptase and PCR steps and (3) only water submitted to PCR steps.

Total genomic DNA was extracted from field-grown asparagus plants naturally infested with different Fusarium species, submitted to PCR amplification, DGGE analysis and sequencing.

The resulting cDNA was submitted to PCR using the forward primer 5′-TGAGTTGCAGAACTGGATCG-3′ and reverse primer 5′-GCAGAACGCCAGAAAACTTC-3′ for detection of the G. graminis lox mRNA.

All samples (groups A and B) were submitted to PCR for dideoxy-sequencing.

Show more...

Similar(38)

Briefly, DNA samples from cases and controls were submitted to PCR-based amplification of a 450 bp segment in the L1 viral gene with MY09 and MY11 primers [ 30].

Samples with positive PCR result were further submitted to another PCR reaction covering a fragment of 417 bp of the S gene as developed by Sitnik et al., 1999 [ 15].

Briefly, samples were first submitted to a PCR using two primers: D75 = 5'– CAGATCTTGGTTGGCGTAG 3' and D72 = 5'– TTTTCAGAATGGCCGAACAGT–3'). Two microliters of these PCR products were used as template in the second PCR round performed in a real time PCR apparatus (ABI7900 - Applied Biosystems), using the primers: D71 (5'-AAGGTGCGTCGACAGTGTGG-3') and D72.

Crude samples were prepared and submitted to nested PCR, allowing amplification of DNA fragments of the expected size when carried out on infected larval and spat samples.

DNA obtained from infected cells was submitted to a PCR assay designed to amplify the part of genome containing TRS specifically either for HHV-6A or HHV-6B.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: