Sentence examples for subjected to parallel from inspiring English sources

Thus, fintrim genes have been probably subjected to parallel – and independent – duplication events in the different branches of teleosts.

Plasma samples were subjected to parallel N-glycoprotein extraction in a 96-well format, followed by targeted quantification of the candidate proteins by SRM.

The EEM signals were processed and subjected to parallel factor analysis (PARAFAC), as described in the study by Lu et al. [ 32].

Samples were subjected to parallel amplification of the constitutively expressed, housekeeping gene, human β-actin using the following primers: forward primer: 5′- TCCTTCTGCATCCTGTCGGC -3′, reverse primer: 5′- CAAGAGATGGCCACGGCTGC -3′.

In our experiments we observed that, for the time points subjected to parallel proteomics and transcriptomic analyses, 62,5% of the protein changes correlate with the transcriptomic data, since for five genes out of 8 analyzed, an agreement was observed between protein accumulation and transcriptional change at the corresponding time points.

Total DNA was extracted by using an EZ1 automated extractor (QIAGEN, Courtaboeuf, France) and subjected to parallel real-time PCRs selective for the Y. pestis pla gene, the Rickettsia prowazekii ompB gene, a Borrelia recurrentis noncoding genomic fragment, and the Bartonella quintana internal transcribed spacer.

Still, the court did not open the accounts to Kazakhstan, because they remain subject to parallel orders issued at the request of the American law enforcement authorities, who have begun their own inquiry.

As an example, Fig. 7 shows the state diagram for a system with n=3 and k=0, subject to parallel rejuvenations.

In addition, morphological characters have been shown to be subject to parallel evolution and extreme reduction, resulting in a paucity of synapomorphies [ 52, 53].

The English master version was subject to parallel translation into the language of choice by independent translators familiar with survey research.

In the developmental plasticity/bias account, the same mutation may appear in isolated populations, often associated with a suit of coordinated phenotypic changes, and is subject to parallel (that is, identical rather than convergent) selection.