Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
All MRI studies were forwarded to an independent core laboratory (MedQIA, Los Angeles, CA, USA) for quality control and interpretation to reduce variability in the measurements; the core laboratory also developed standardized imaging protocols for use at the individual trial sites, credentialed the sites, and trained MRI technologists at each trial site.
All MRI studies were forwarded to a core laboratory (MedQIA, 924 Westwood Blvd., Suite 650, Los Angeles, CA 90024, USA) for quality control and interpretation to reduce variability in the measurements; the core laboratory also developed standardized imaging protocols for use at the individual study sites, credentialed the sites, and trained MRI technologists at each study site.
Similar(57)
Names of the offending artemisinin monotherapy producers in this study were forwarded to the WHO.
The full details of this study were forwarded to the Ethics Committee on Experimentation in the Use of Live Animals of the School of Veterinary Medicine and Animal Science, UNESP, Botucatu, Sao Paulo, Brazil.
Contact details of prospective participants who expressed interest in taking part in the study were forwarded to the researcher, who followed-up to provide more information and answer questions about the study, and obtain consent.
Letters of invitation, which made reference to a physical examination as a component of the study, were forwarded to potential participants and a nurse followed with a phone call to schedule an appointment within 7 days.
An e-flyer advertising the study was forwarded by the Australian Osteopathic Association AOAA) to all current members.
A request for photocopies of the each of the surveys selected for the reliability study was forwarded by CMS through NCQA to the six vendors.
The included studies were forward and backward searched.
Primer sequences for the EGFR gene used in this study were: forward, CCACCAAATTAGCCTGGACA; reverse, CGCGACCCTTAGGTATTCTG. EGFR gene copy number > 3 was defined as positive [ 21].
Each study site collected the same data and used the same methods, and data collected by staff in each study setting were forwarded to the Evaluation Lead and specialist survey designer for analysis.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com