First Book secures discounts for its customers — three dollars for a paperback instead of ten dollars — but it still works within the established corporate structure of the publishing industry; many would like to see this side-stepped completely.
Some of the limitations of the DataCite Media API-resource and Content Resolver described in "Method 2" can be overcome by exposing the directory structure of the published fileset in a machine discoverable and readable way.
Thus, to resolve the issue, the contig was broken up and reassembled by Megamerger as along with manual rearrangement to follow the conserved structure of the published chloroplast genomes of the land plants.
As before, the structure of the previously published long from was used as the standard of comparison for the present short-form structure.
The crystal structure of Mtb SeMet-BfrA has been determined by Molecular Replacement (MR) using the structure of the recently published M. smegmatis BfrA as template [19] and refined to a final Rwork value of 19% and an Rfree value of 23% at 2.5 Å resolution.
β-actin forward (TCCCTGGAGAAGAGCTACG) and reverse (GTAGTTTCGTGGAT GCCACA) primers and SELENBP1 forward (TCATCAGGGAAGGCTCTGTGA) and reverse (GGGTGCCAAGAGAGAGCAGAA) primers were designed using the computer program OLIGO based on the cDNA structure of the genes published in Genebank.
Comparison of the structures and biodistribution of the published tetrazines [2, 4, 9 13, 19, 20, 22] for pretargeted PET imaging shows that there are multiple factors that contribute to the pharmacokinetic profile.
The published structures of the prion protein and its paralog Doppel were the only structures that fulfilled both of these criteria.
The weight-average sedimentation coefficients (sw) for both samples are between those calculated for a monomer and a dimer based on the published structures of the regulatory domains of PheH and TyrH, consistent with a monomer dimer equilibrium for RDPheH.
Comparison between the published structures of the four RBDs in their interactor-free states reveals little pointing to the distinct interactor specificity of p110β (R. Chaleil and P. Bates, personal communication).
