Your English writing platform
Discover LudwigSuggestions(5)
Exact(1)
First Book secures discounts for its customers — three dollars for a paperback instead of ten dollars — but it still works within the established corporate structure of the publishing industry; many would like to see this side-stepped completely.
Similar(59)
Some of the limitations of the DataCite Media API-resource and Content Resolver described in "Method 2" can be overcome by exposing the directory structure of the published fileset in a machine discoverable and readable way.
Thus, to resolve the issue, the contig was broken up and reassembled by Megamerger as along with manual rearrangement to follow the conserved structure of the published chloroplast genomes of the land plants.
In 1999, entrepreneur A reorganized the ownership structures of the publishing house.
As before, the structure of the previously published long from was used as the standard of comparison for the present short-form structure.
The crystal structure of Mtb SeMet-BfrA has been determined by Molecular Replacement (MR) using the structure of the recently published M. smegmatis BfrA as template [19] and refined to a final Rwork value of 19% and an Rfree value of 23% at 2.5 Å resolution.
β-actin forward (TCCCTGGAGAAGAGCTACG) and reverse (GTAGTTTCGTGGAT GCCACA) primers and SELENBP1 forward (TCATCAGGGAAGGCTCTGTGA) and reverse (GGGTGCCAAGAGAGAGCAGAA) primers were designed using the computer program OLIGO based on the cDNA structure of the genes published in Genebank.
The Stubborn Structure: Essays on Criticism and Society appeared in 1970, and The Great Code: The Bible and Literature, a study of the mythology and structure of the Bible, was published in 1982.
He discovered geology and botany, purchasing, in 1841, a pamphlet on the structure of plants published by the Society for the Diffusion of Useful Knowledge.
"Of course, the structure of publishing can't change quickly because publishers are controlled by the state," she said, sipping tea in a stylish suit, about to fly off on a national book tour.
[3] Thomas Kuhn in his book, The Structure of Scientific Revolutions published in 1962, originated the concept of paradigm in the scientific world.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com