We generated a model of PSTPIP1 molecular structure, based on the published structure of the FBP17 dimer [18].
As before, the structure of the previously published long from was used as the standard of comparison for the present short-form structure.
The crystal structure of Mtb SeMet-BfrA has been determined by Molecular Replacement (MR) using the structure of the recently published M. smegmatis BfrA as template [19] and refined to a final Rwork value of 19% and an Rfree value of 23% at 2.5 Å resolution.
β-actin forward (TCCCTGGAGAAGAGCTACG) and reverse (GTAGTTTCGTGGAT GCCACA) primers and SELENBP1 forward (TCATCAGGGAAGGCTCTGTGA) and reverse (GGGTGCCAAGAGAGAGCAGAA) primers were designed using the computer program OLIGO based on the cDNA structure of the genes published in Genebank.
Comparison of the structures and biodistribution of the published tetrazines [2, 4, 9 13, 19, 20, 22] for pretargeted PET imaging shows that there are multiple factors that contribute to the pharmacokinetic profile.
First Book secures discounts for its customers — three dollars for a paperback instead of ten dollars — but it still works within the established corporate structure of the publishing industry; many would like to see this side-stepped completely.
Comparison of the structure of GAD6765loop with the published GAD67WT structure (PDB ID 2OKJ) revealed certain interesting and important findings.
Similarly, C-ME is being used to provide a tour of a completed crystal structure using the published research paper as a basis.
He discovered geology and botany, purchasing, in 1841, a pamphlet on the structure of plants published by the Society for the Diffusion of Useful Knowledge.
