Exact(3)
Sleek barstools face enormous windows that stretch to the second floor, where a loftlike dining room overlooks more tables, an open kitchen and a shaggy green vertical garden.
For the genomic stretch 3' to the second exon, the oligos 5'AATGGCGCGCCTGAGTCCGAATGTGAGCTTGA3' (Asc1 overhang) and 5'AATCGTACGCCATTTCTCCAAGGAGGTGAA3' (BsiW1 overhang) were used to amplify an approximately 4 Kb product from genomic DNA and cloned into the same sites in pW25 to generate the targeting construct.
For the genomic stretch 5' to the second exon, the oligos 5'AATGCGGCCGCACTCCAAGGACTGCTCCACTC3' (Noverhanghand) and 5'AATGGTACCGATTCTGGAGCAAGGGGACTT3' (Acc65I overhang) were used to amplify an approximately 4 Kb product from genomic DNA and cloned into the same sites in pW25.
Similar(57)
It seemed appropriate, then, that the injury-worn Knicks would be forced to turn for a stretch to the third-year guard Toney Douglas.
That ruled him out of the first two Tests against New Zealand and, while there has been no setback, his absence is likely to stretch to the third and final match in the series, starting at Trent Bridge on 5 June.
They have trailed for only 6 33 of the season, a span that stretches to the second quarter of their opener against Oregon.
Three break points for the American: cracking backhand volley on the stretch to save the first, but the second goes Davenport's way with an easy smash.
Chowder's First ran down West Virginia, the 1-to-2 favorite, in the stretch to win the second running of the New York Stallion Series Cab Calloway Division by a neck Wednesday at Saratoga Race Course.
He watched on television as Rags to Riches ran down Curlin in the stretch to become the third filly and the first in 102 years to win the Belmont.
Tampa Bay must go 10-3 down the stretch to avoid the first 100-loss season in the four-year history of the franchise.
Ridden by Mike Smith and trained by Bob Baffert — both Hall of Famers — Richard's Kid had a strong run through the stretch to provide the third-biggest upset in the Pacific Classic's 19-year history.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com