Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
Although he was unhappy with the strategy set forward by his brother, the Holy Roman Emperor Francis II, he had acquiesced to the less ambitious plan to which Francis and the Aulic council had agreed: Austria would fight a defensive war and would maintain a continuous defensive line from the Danube to northern Italy.
Although Charles was unhappy with the strategy set forward by his brother, the Holy Roman Emperor Francis II, he had acquiesced to the less ambitious plan to which Francis and his advisers, the Aulic council, had agreed: Austria would fight a defensive war and would maintain a continuous defensive line from the southern bank of the Danube, across the Swiss Cantons and into northern Italy.
Similar(58)
Strategy set in stone.
Evidence-informed communication strategies set against the media landscape will ensure the ethical translation of this biotechnology as it moves forward to clinical application.
The group hashed out strategy going forward but set no timetable for action.
hsf-1 primer set 1: forward: TTGACGACGACAAGCTTCCAGT; reverse: AAAGCTTGCACCAGAATCATCCC. hsf-1 primer set 2: forward: GTCTCTGTCATGCAGCCAGG; reverse: TTGGGTCCGGCAGTTCC.
Indigenous voices and strategies themselves must set our pathway forward.
His business strategy was set.
By that time, strategy was set.
The current strategy is set to expire in 2018.
What is the strategy with setting all of that up moving forward?
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com