Sentence examples for strategy set forward from inspiring English sources
Although he was unhappy with the strategy set forward by his brother, the Holy Roman Emperor Francis II, he had acquiesced to the less ambitious plan to which Francis and the Aulic council had agreed: Austria would fight a defensive war and would maintain a continuous defensive line from the Danube to northern Italy.
Although Charles was unhappy with the strategy set forward by his brother, the Holy Roman Emperor Francis II, he had acquiesced to the less ambitious plan to which Francis and his advisers, the Aulic council, had agreed: Austria would fight a defensive war and would maintain a continuous defensive line from the southern bank of the Danube, across the Swiss Cantons and into northern Italy.
Evidence-informed communication strategies set against the media landscape will ensure the ethical translation of this biotechnology as it moves forward to clinical application.
The group hashed out strategy going forward but set no timetable for action.
hsf-1 primer set 1: forward: TTGACGACGACAAGCTTCCAGT; reverse: AAAGCTTGCACCAGAATCATCCC. hsf-1 primer set 2: forward: GTCTCTGTCATGCAGCCAGG; reverse: TTGGGTCCGGCAGTTCC.
Indigenous voices and strategies themselves must set our pathway forward.
His business strategy was set.
By that time, strategy was set.
The current strategy is set to expire in 2018.
What is the strategy with setting all of that up moving forward?
