Sentence examples for strands against from inspiring English sources

Exact(6)

Two target-specific siRNAs against Trx were designed and synthesized by Dharmacon (Lafayette, CO, USA, sense, GUGAUAAACUUGUAGUAGUUU); and Santa Cruz Biotechnology (a pool of three strands against Trx mRNA; sense, CAUCCCUGGUGACAAAGAATT, GAAGGGAUGCAUCCAUGAATT, and GCGAUCAACUCUAGCCAAATT).

In their analysis of 43 bacterial chromosomes, Lobry and Sueoka [ 29] plotted GC and AT skews at the third codon positions on the two replicating strands against each other, from which RAP and TAP were derived graphically.

To protect your strands against breakage, you should be careful about when you untangle your hair.

This helps keep the woven fabric smooth and flat after you beat or press the strands against each other.

And though it should go without saying, always, always, always use a heat protectant on your hair to defend your strands against the heat.[1].

You should address tangled hair: To protect your strands against breakage, you should be careful about when you untangle your hair.

Similar(54)

The β-barrel construction is described by the number of strands and the shear number, which is a measure for the inclination angle of the β-strands against the barrel axis.

Corneal sensitivity testing by comparison of a light touch with a cotton wool strand against the normal fellow eye was performed and recorded as normal, reduced, or absent.

This threshold can be identified by comparing the distribution of paired-end reads mapping to the same-strand against those aligning to different strands.

We excluded candidates that were unlikely to be biologically significant – generally, short ORFs that were encoded on the opposite strand against much larger ORFs – and were left with 53 likely novel ORFs (Additional file 4, Basis code "A").

It is also unclear whether the lower mutation rate means that the rate of DNA copying is slower, and that there is consequently more time for checking the new strand against the old strand how does a lower mutation rate really occur?

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: