Similar(60)
For example, if, and dropping the site and species subscripts for simplicity, then, where is determined by the predicted time spent single stranded at site i based on the slope and intercept parameters.
A Ter site (bold) was synthesized by annealing two complementary oligos: CCGGC CACTTTAGTTACAACATACTTATTAT CGATAATAAGTATGTTGTAACTAAAGTGG Following annealing, these oligos form a double stranded Ter site with ClaI and NgoMIV overhangs.
The meteorological and the logistic conditions at the stranding site did not allow any refloating effort, so that the three animals died within 48 hours.
The "Hellenic Trench", the likely winter aggregation area, is 600 km (Lefkada Island) to 1100 km (Crete) away from the stranding site (distance calculated on a straight way with no deviation due to marine currents).
A continuous long and narrow sandy coastline that faces the rather shallow central part of the basin, with a mean depth of 180 m, characterizes the vast majority the Italian side of the Adriatic Sea, including the stranding site.
This landscape is a potential stranding site for sea turtles that do not migrate down south before the change of season.
The gene copy on the minus strand (site 3), which we designate ADH-2, had four matching F-ESTs, providing full coding sequence coverage.
The order of the two integration steps shown in Figure 1 is not yet known, although it has been suggested that the reaction on the minus strand (site 2) occurs first in E. coli (Nuñez et al., 2015).
The gene copy on the plus strand (site 4) corresponds to the originally sequenced ADH gene from F. × ananassa [ 20], in recognition of which we designate it ADH-1.
Robots keep getting fried on their missions, literally from radiation damage, or stranded on-site wasting precious money and time.
However, significant changes in the βII strand active site residues are observed upon 2-OG binding (βII supports two of the three metal binding residues).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com