Sentence examples for strand driver from inspiring English sources

Double strand driver cDNA was prepared by low cycling PCR using phosphorylated driver3 primer and driver5 primer (TCCTAAGGTAGCGAGGCCATTACGGCCGGG) which is complementary to the 5'driver adaptor.

Double strand driver cDNA was synthesised using driver3 primer which is phosphorylated and driver5 primer (TCCTAAGGTAGCGAGGCCATTACGGCCGGG) which is complementary to the 5' driver adaptor.

The anti-sense strand of the double strand driver cDNA which is phosphorylated at the 5'end was destroyed by treating it with lambda exonuclease.

Tester DNA was then melted and reannealed with an excess of driver DNA and the remaining single strand driver DNA (normalized or subtracted library) was then purified by hydroxyapatite chromatography.

And a passer-by will be determined to help a stranded driver change a tire.

Mr. Parker had taken his wrecker out in the darkest part of the storm on Wednesday night, trying to help a stranded driver.

The stranded driver seeks shelter at a nearby house — always a bad idea when you're a character in a gothic horror spoof, and even more so when it's as gory and gleefully dark as Mr. Fleck's delightfully deranged solo show, "Blacktop Highway," which soon layers video into the mix.

Driver crawls across ladder in US floods Jump to media player Firefighters in Texas extend a ladder to a stranded driver as the floodwaters wreak havoc below.

Because he knew how frustrated the customer was and how hot a day it was, the technician brought the stranded driver a cold drink.

Dyfed-Powys Police said it had received dozens of calls, including of roads becoming impassable due to flash floods and of a stranded driver.

Dyfed-Powys Police received dozens of calls, including reports of roads becoming impassable due to flash floods and one of a stranded driver.