Sentence examples for strand against from inspiring English sources

Corneal sensitivity testing by comparison of a light touch with a cotton wool strand against the normal fellow eye was performed and recorded as normal, reduced, or absent.

We excluded candidates that were unlikely to be biologically significant – generally, short ORFs that were encoded on the opposite strand against much larger ORFs – and were left with 53 likely novel ORFs (Additional file 4, Basis code "A").

It is also unclear whether the lower mutation rate means that the rate of DNA copying is slower, and that there is consequently more time for checking the new strand against the old strand how does a lower mutation rate really occur?

Hold the middle strands taut as you gently tighten the wrapped side strand against the previous knot.

The header is the first strand against which the rest of your hemp yarn will be "beat" or pressed against when you weave hemp.

The β-barrel construction is described by the number of strands and the shear number, which is a measure for the inclination angle of the β-strands against the barrel axis.

This threshold can be identified by comparing the distribution of paired-end reads mapping to the same-strand against those aligning to different strands.

Two target-specific siRNAs against Trx were designed and synthesized by Dharmacon (Lafayette, CO, USA, sense, GUGAUAAACUUGUAGUAGUUU); and Santa Cruz Biotechnology (a pool of three strands against Trx mRNA; sense, CAUCCCUGGUGACAAAGAATT, GAAGGGAUGCAUCCAUGAATT, and GCGAUCAACUCUAGCCAAATT).

In their analysis of 43 bacterial chromosomes, Lobry and Sueoka [ 29] plotted GC and AT skews at the third codon positions on the two replicating strands against each other, from which RAP and TAP were derived graphically.

To protect your strands against breakage, you should be careful about when you untangle your hair.

This helps keep the woven fabric smooth and flat after you beat or press the strands against each other.