Sentence examples for strains were selected on from inspiring English sources
Diploid strains were selected on the basis of colony size (Shima et al. 1999), yielding strain ER HAA1-OP.
3 microbial strains were selected on the basis of their clinical importance in causing diseases in humans.
In the second recombinant, the duplicated fragments of och1 were exchanged and the och1 deletion strains were selected on the plates containing 5-FOA, but no adenine.
Engineered yeast strains were selected on solid YNB medium (6.7 g L−1 Yeast Nitrogen Base without amino acids (Becton, Dickinson and Company, USA) supplemented with 20 g L−1 glucose or xylose and 15 g L−1 agar).
Plasmid containing yeast strains were selected on synthetic dextrose (SD) medium, prepared with 6.7 g L-1 yeast nitrogen base without amino acids (YNB-AA) (Formedium, Hunstanton, UK) and 20 g L-1 glucose with complete supplement mixture (CSM) lacking uracil and/or histidine (Formedium) where appropriate.
The corresponding NalR strains were selected on tryptic soy agar containing 25 µg/ml of the antibiotic.
Starter strains are selected on the basis of their capacity to promote the transformation of malate in a panel of wines.
Full length genes OsMPK20-4 and OsMPK3, in-frame cloned in pGADT7 & pGBKT7 vectors (Clontech) and transformed in AH109 yeast strain were selected on QDO medium at 30°C for one to one interaction.
Mutations able to suppress the elevated calcium requirement of a halAΔ sltAΔ strain were selected on medium containing BAPTA but no added calcium after ultraviolet mutagenesis (Fig. 7A).
The PCR product was transformed using standard methods [75] and TIF4631 or TIF4632Δ strains were selected for on Synthetic Complete (SC) (-ura) and confirmed by PCR with forward primers ∼200 bp upstream of the replaced ORF (TIF4631: CCGCGTTCTCTGTGTGCAACGGATG; TIF4632: GAGGTAAACACAGCAAACGACCAC) and reverse primers within the URA3 marker sequence (GCTTGGCAGCAACAGGACTAGGATG).
Yeast strains were transformed with the lithium acetate method [ 28] and transformed yeast strains were selected for prototrophy on defined mineral medium plates containing 20 g l-1 glucose.
