Sentence examples for strains was determined using from inspiring English sources
Between the surface and the highly damaged region, the local distribution of strains was determined using large angle convergent beam electron diffraction.
The potency of rHA derived from several influenza strains was determined using single radial immunodiffusion (SRID), and the structure of the rHA was characterized using SDS PAGE and dynamic light scattering.
Survival curve of all V. parahaemolyticus strains was determined using an Excel program.
The copy number of the xylA gene integrated into the chromosomes of the recombinant strains was determined using quantitative real-time PCR (qRT-PCR) performed on an Mx3000P QPCR System (Agilent Technologies, Palo Alto, CA, USA) with Thunderbird SYBR qPCR Mix (Toyobo, Osaka, Japan).
Toxicity of strains was determined using HPLC at the Norwegian Veterinary Institute, Oslo, Norway [37] or LCMS at the Cawthron Institute, Nelson, New Zealand.
Statistical significance of the difference between white and opaque a/a strains was determined using the t-test assuming unequal variations data analysis function in Microsoft Excel (Microsoft Corporation, Redmond, Washington, United States), setting a p-value of less than.001 for the one-tailed distribution as the significance threshold.
The presence (6.4 kb band) or absence (876 bp band) of this mdg3 transposon in different fly strains was determine using PCR primer pairs P1 TCGAGCGTGTTTATGCTTTG) and P2 (TTGTCACACTCTGAGGCCAG) (see Figure 2Ci).
Furthermore, the nearly complete gene segment-2 sequences of three other AGM PBV strains were determined using primers designed from gene segment-2 sequence of 016593.
MICs for the strains were determined using the broth microdilution method.
The premutations from H. pylori strains were determined using program GenVar [41] in combination with the annotation of Genbank.
DAP– colonies were screened by PCR using primer 1 and 4. Biochemical profiles of E. ictaluri strains were determined using the API 20E system (bioMériux, Marcy I'Etoile, France).
