Sentence examples for stop detection from inspiring English sources

To our knowledge, no works in literature deal with the problem of "tracking" scratches, as they typically stop detection when they find the position of the (vertical) line.

Hence, a more robust rule is obtained to stop detection event and the B-scan target data estimate gets better to create true spatial information over the buried object.

Analogously, the average time-lag between offset and the following stop of detection is considered for OVER.

Finally, a combined graph allows us to stop the detection process at that location early when only one suitable person is found in the dyad.

Pair 2 (CCTCATTTGCTGTCCTGGTT, CCCTGGTGTCCTGTCATCTT, product 208 bp) binds to intronic sequences around the insertion site of the stop and detection cassette and differentiates between hom and wt/het genotypes.

Information such as gap, headway, stopped-vehicle detection, speeding vehicle, and class of a vehicle can be useful for intelligent transportation systems [1].

However, raised awareness caused by the outbreak investigation and the resulting intensification of in-factory sanitation stopped the detection of the cluster strain in food samples (Fig. 3).

Figure 8 A problematic situation in terms of detection stop.

For cortical areas of the network, research indicates that when there is a stopping process commencing from detection of a stop-signal, the right inferior frontal gyrus signals and commands the basal ganglia to stop the intended action23.

No cholera epidemic can be stopped by early detection and antibiotic treatment - as effective and important as these are.

The vehicles are designed so that hydrogen leaks from the tank are stopped automatically upon detection of hydrogen leakage or detection of impact in a collision.