Your English writing platform
Discover LudwigSuggestions(5)
Exact(1)
This stimulating element of surprise is even rarer in printed sentences, so we were delighted when we ran across one that we feel takes the cake.
Similar(59)
The wide spectrum of temporal frequencies used undoubtedly stimulates elements of both the faster luminance and slower color pathways.
Hepatic transcriptional factors that play crucial roles in the regulation of lipogenic gene expression include the upstream stimulating factor (USF), sterol regulatory element-binding protein-1c (SREBP-1c), liver X receptor (LXR), and carbohydrate-responsive element-binding protein (ChREBP).
This transcription factor will initiate the transcription of hundred of interferon stimulated genes (ISGs) containing interferon stimulated response element (ISRE).
BM = bone marrow; ERE = estrogen responsive element; FSH = follicle stimulating hormone; IFN = interferon; IL = interleukin; M-CSF = macrophage colony stimulating factor; OB = osteoblast; OC = osteoclast; ovx = ovariectomy; RANK = receptor activator of NF-κB; RANKL = RANKL ligand; TGF = transforming growth factor; TNF, tumor necrosis factor.
Chinese hamster ovary (CHO-K1) cells were stably transfected with secretory alkaline phosphatase (SEAP) gene under the control of interferon stimulated response element (ISRE) promoter.
In cells expressing the HCV protease, cIRF7 was cleaved and the processed fragment was migrated into the nucleus, where it activated various IFN promoters, including promoters of IFNα6, IFNβ, and IFN stimulated response element.
The activated STATs then form homodimers or heterodimers and translocate into the nucleus, bind to conserved promoter sequences termed interferon stimulated response element (ISRE), and induce the transcription of IFN-responsive genes.
Equivalent amounts of whole-cell extract (20 µg) or various amounts of recombinant proteins were assayed for IRF-3, IRF-5, IRF-5P68 and IRF-7 binding by gel shift analysis using a 32P-labled double-stranded oligonucleotide corresponding to the interferon stimulated response element (ISRE) region of the ISG15 promoter (5'GATCGGAAAGGGAAACCGAAACTGAAGCC3').
The PML promoter contains an IFNα/β stimulated response element and an IFNγ binding site [ 103, 104].
ISRE (Interferon Stimulated Response Element) motifs are involved in the regulation of gene expression in response to interferon type 1 (IFNA-alpha/beta) activation [ 17].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com