Sentence examples for still further downstream from inspiring English sources
The transcription initiation site for isoform-4 (BMCC1-4/KIAA0367/BNIPXL/AY43213) reported by Soh and Low [24] is located still further downstream within the second exon of BMCC1-3.
Observations on the still further downstream mismatch repair (MMR) pathway are also consistent with theoretical expectations.
The rivers further downstream, in New Mexico and Utah, however, were relatively pristine before the accident, according to Jen Pelz, of the conservation group Wildearth Guardians.
As a control another C to T point mutation was introduced further downstream at −660 to the TSS, but still within the same internal region using 5′ GCCTGGCGCACTCACTTCCGCGTCCCGC TGCCCTCCGG (forward) and 5′ CCGGAGGGC AGCGGGACGCGGAAGTGAGTGCGCCAGGC (reverse).
The further downstream a problem moves, however, the harder and more expensive it becomes to fix.
Nevertheless, the method still provides valuable epidemiological data and proves extremely useful for prioritising isolates for further downstream analyses.
Our approach considerably reduces the barriers that still limit the usability of the powerful NGS technology and finally decreases the time to be spent before proceeding to further downstream analysis and interpretation of the data.
Then they will try to find the female further downstream.
Meander through the tranquil grounds of the New York Botanic Gardens, or zip through rapids further downstream.
Further downstream, where the water is deeper, he has a swimming hole and a diving board.
