Sentence examples for steps overlap with from inspiring English sources

We performed the following annotation steps: Overlap with known D. melanogaster annotation We used the coordinates of a set of D. melanogaster non-coding RNAs, publicly available as gff files at [ 46] and [ 31, 47] to identify already known D. melanogaster ncRNAs among our predictions.

Inspection of the data revealed the following remarks : (i) Elimination of the solvated methanol/hydrated water molecules occurs in a separate step or overlapped with the removal of the coordinated ones.

First, there is a redundancy between these profiles, caused by the way the origins are obtained: they overlap with a step of 10 residues.

If sequence searches in Step 2 identified fragments that overlap with the erroneous sequence but differ from it in the region affected by the error, then FixPred uses the overlapping fragments to reconstruct sequences (Supplementary Figure S2 ).

In a final step, all residue entries were dropped, which overlap with any preceding entry in the file or exhibit an internal atom overlap.

Forward primer: GGGGACAAGTTTGTACAAAAAAGCA GGCTCCACCATG; reverse primer: GGGGACCACTTTGTACAAG AAAGCTGGGTG (underlined sequences overlap with primers of first-step PCR).

As the first step in the agreement, automakers said they would adjust the bumper heights of their S.U.V.'s and pickups to overlap with at least half of the bumpers of cars.

They overlap with Jackie Kennedy's state visit.

And the way the three parts of the story overlap, just as the men overlap and the cafés overlap and the train overlaps, makes us think about the way our own lives overlap with one another.

"We overlap with the discounters more than anybody else, our customers have felt the austerity programme more than anybody else and these are bold steps to put us back on track.

Spirit nominations often overlap with Oscar contenders.