Sentence examples for started underlining from inspiring English sources

"I just started underlining the claims that were faulty".

I started underlining and asterisking the quotable ones and now my copy is pretty much unreadable.

Mrs. Lee started underlining passages after she was approached by an Orange County Register reporter who described some similarities in language but who focused on differences between the facts of Modjeska's life in a home in the Santa Ana foothills in the 1870's and the fictional tale of Ms. Sontag's actress, Maryna.

At the beginning of our 56-minute phone conversation last week, I told Wright that I started underlining every page of her book.

The exception was St Helens, for whom Luke Walsh has made such an outstanding start, underlining the impact that can be made by an established playmaker from Australia.

Unable to contain himself, Gove leant forward for some paper and started scribbling, underlining key points several times.

It starts by underlining the theory-dependency of scientific methodology, which comprises methods for designing experiments, for assessing data, for choosing between rival hypotheses, and so on.

A flat tax that started last January underlined the change, he says.

This tag is what starts the underlining of the text.

The vector was prepared by PCR amplification of PL458 with two oligonucleotides that only excluded the sequence coding for PNP1 20 using the sense primer 5′ ATG GACAGCGATGACCGCGTG 3′ (with Met-MTGase start codon underlined) and the antisense primer 5′ GGA AGAATTCGTAATCATGGTCATAGCTG 3′ (where the first underlined codon is the complementary codon for the last aminoacid of LacZ1 8 fragment).

The released messages begin by underlining what an ordinary day it had started out to be.