Sentence examples for stark discussion from inspiring English sources

A stark discussion about the morning-after pill might be the one thing that can put them right off.

There's also glossary of words of the authors' own invention, and it's all in quick-fire paperback – a deliberately archaic format for such stark discussions about our present and future.

There was a stark choice of discussion priorities here: whether punters should be refunded their Sariska bets, or the fight against corruption.

This difference in the activity for correct rejections could indicate a dissociation according to recollection vs. familiarity or it could result from activity associated with incidental encoding of the novel foils (for further discussion, see Stark and Squire, 2003).

There were discussions among Stark's team, around this time, about the possibility of transforming the ground floor into an estate agent's office.

A housekeeping gene (GAPDH) was used as an internal control (Forward: GGCTCTCCAGAACATCATCCCTGC, Reverse: GGGTGTCGCTGTTGAAGTCAGAGG). The authors would like to thank Dr. George Stark and the members of Stark laboratory for the discussions of issues related to insertional mutagenesis.

The US president was greeted at the Vatican with a display of pomp that was in stark contrast to their expected discussion on how to tackle poverty and inequality.

Last weekend, in a valuable addition to the discussion, the Pentagon published a stark report that should dampen some of these imaginings.

Yet, in spite of the absence of guns and fistfights, the film's iconic dinner scene is remembered as one of the film's most tense moments, showing the stark disintegration of a family's political discussion over carved beef.

The union said that after three years of discussions firefighters still faced a stark choice of being sacked or having their pension severely reduced.

The union said after three years of discussions, firefighters still faced a stark choice of being sacked or having their pension severely reduced.