Sentence examples for standards and reference from inspiring English sources

Rethinking standards and reference models     11.

All samples, standards and reference materials, were analyzed in triplicate.

Standards and reference models (e.g. W3C POI) are crucial in coping with such design principles.

The samples were analysed in duplicate by each laboratory along with a solution of PCDD/F standards and reference sediment.

Finally, we evaluate the contribution of this approach to enterprise maturity in the application of standards and reference models, using Nascio's Enterprise Architecture Maturity Model.

This has led to a call for suitable standards and reference materials, and the specific needs of UK users were identified at an NPL workshop in 2005.

The spirometry technique met international standards, and references values were those of the European Respiratory Society (Quanjer et al. 1993).

Implementation of standards and references will lead to a better understanding of the relationship among the gene expression measures from different technologies [ Andersen and Foy, 2005; Kawasaki, 2006].

Adding with such complete cloud service standard and reference support, OCSO has the potential to achieve much more for advanced service optimization scenarios.

RP49 which encodes the ribosomal protein L32 was used as an internal standard and reference gene using forward and reverse primer pairs 5'CTGCTCandCAGAACCGCGT3' and 5'GGACCGACAGCTGCTTGGCG3', respectively.

GAPDH was used as internal standard and reference gene.