Sentence examples for stages of expression from inspiring English sources

With a contract value of £8.4m, the process used the official TfL Engineering & Project Management Framework and went through the proper formal stages of Expression of Interest and Invitation to Tender.

Theoretically, various stages of expression could be affected under FtsY-depletion conditions, several of which were examined here.

A second route shows a loss of catalytic potential, "Glu lost", where the xylanase inhibitory property could emerge in a group of naturally inactivated chitinases, such as Concanavalin B. Three samples representing stages of expression and purification of CaclXIP were assayed for chitinolytic activity.

Further experiments suggested that raising the induction temperature can benefit the transport of recombinant enzyme and compensate for the decreased rate of recombinant enzyme synthesis during the later stage of expression.

Most of the alternative BORIS transcripts possessed a polyA tail located 20 30 bp downstream from the canonical polyadenylation signal, AAUAAA (File S1), indicating that BORIS isoforms reached the stage of expression as mature mRNAs.

These include dispensability of the protein, developmental stage of expression, breadth of expression in different tissues, expression level.

The possibility of proteolytic release was designed at the stage of expression vector construction.

The information about the tissue and stage of expression might facilitate the experimental confirmation of these predicted miRNAs.

Finally, when classifying genes into specific developmental stages using a series of increasing stage-specificity thresholds, we found a significant correlation between specificity of temporal stage of expression and evolutionary rate.

The possibility of proteolytic release was designed at the stage of expression vector construction: the sequence coding for the protease-recognized motif (GAAAACCTGTATTTTCAGGGC: ENLYFQG, AcTEV protease) was introduced by a PCR primer between the hoc gene and the affinity motif.

In the early stages of differential expression analysis, techniques for identifying genes with varying expression patterns in cancer and normal cells have been developed.