Sentence examples for stage of expression from inspiring English sources

Further experiments suggested that raising the induction temperature can benefit the transport of recombinant enzyme and compensate for the decreased rate of recombinant enzyme synthesis during the later stage of expression.

Most of the alternative BORIS transcripts possessed a polyA tail located 20 30 bp downstream from the canonical polyadenylation signal, AAUAAA (File S1), indicating that BORIS isoforms reached the stage of expression as mature mRNAs.

The possibility of proteolytic release was designed at the stage of expression vector construction.

These include dispensability of the protein, developmental stage of expression, breadth of expression in different tissues, expression level.

The information about the tissue and stage of expression might facilitate the experimental confirmation of these predicted miRNAs.

The possibility of proteolytic release was designed at the stage of expression vector construction: the sequence coding for the protease-recognized motif (GAAAACCTGTATTTTCAGGGC: ENLYFQG, AcTEV protease) was introduced by a PCR primer between the hoc gene and the affinity motif.

So this allows us to see very early stages of expression.

With a contract value of £8.4m, the process used the official TfL Engineering & Project Management Framework and went through the proper formal stages of Expression of Interest and Invitation to Tender.

Theoretically, various stages of expression could be affected under FtsY-depletion conditions, several of which were examined here.

Protein expression, the final stage of gene expression, changes dynamically in a spatiotemporal manner and varies with post-translational processing and chemical modifications.

We also investigated the developmental and bloodmeal stage specificity of expression.