Sentence examples for ssa I from inspiring English sources

Lastly, the SParSE runtime per parameter sample is of the same order as that of the stochastic simulation algorithm (SSA), i.e., the algorithm complexity is independent of the number of unknown parameters for a given system.

Semi-structured interviews were held with important stakeholders of the SSA, i.e. decision makers (board and management; n = 5), implementers (management and staff; n = 5) and users (insurance physicians and labour experts; n = 17), and representatives of national temporary work agencies (n = 3).

For an overview of the steps of the new participatory RTW program and the stakeholders involved, see figure 2. All participants receive usual care by the insurance physician of the SSA, i.e. treatment/guidance according to Dutch guidelines for occupational health care.

In addition to the limited capacity to supply seeds, there are also problems with regard to the physical genetic quality of some of the seeds distributed by the formal system in SSA, i.e. that seed lots are not true to type [ 9, 21, 23, 49].

Nurses were more likely to say that the SSA did not fit with their perception of their role, culture or the work they do: 'When we were evaluating the new SSA, I had quite a lot of comments from nurses saying I will not be filling in this section around employability, house care and finances because I'm a nurse and that's a social worker's job'.

Some of these were also selected in STM1 (ssaI ssaH ssaR ssaT sifB) but not in STY2.

B73 sample was then compared to inbred line B73 from Scuola Superiore Sant'Anna (B73-SSA, i.e., the parental line of the original B73 × H99 cross) in order to determine the level of divergence between samples from different seed stocks.

There was little overall difference in the accuracy of gEBV estimated from SC2-SSAI and SC2-SSMi.

For trait 2 and trait 3, the accuracy of SC2-SSAI was 0.51 and 0.60, while for SC1 it was 0.39.

The two basic assumptions of the SSA are (i) that individual molecules are not explicitly tracked, and (ii) there are frequent non-reactive collisions.

The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.