Sentence examples for split procedures from inspiring English sources

Split procedures have proven their efficiency within global optimization frameworks for routing problems by splitting giant tours into trips.

k-means is used in split procedure to produce initial regions.

The GA is based on a permutation chromosome, a split procedure and local search.

This is because the merging process in the proposed method starts with the regions obtained from split procedure instead of individual pixels used in graph-based technique.

Experiments show that the depth first search split procedure introduced in this article, used as an evaluation function in a global framework, can improve the results obtained by the use of the "classical" split procedure on the Location-Routing Problem and the Heterogeneous Vehicle Routing Problem.

The experiments showed that the proposed method is faster than graph-based algorithm because of using regions resulted from split procedure as the initial universe instead of pixels and higher quality than k-means only method.

In this study, we propose a Split procedure to minimize the number of partitions for a given sequence of nodes, considering local and global capacity constraints on the partitions.

An oligonucleotide was synthesized by "mix and split" procedure which contained the complete (G2W5 4 sequence repertoire flanked by constant regions (tagrep; CCTTAATTAATACGACTCACTATAG(G2W5 4CCCGGGGG).

In experiment 1, seniors were divided into 2 sub-groups according to their score for odor "semantic associations" (from 0 to 20: see above) using a median split procedure (given that 30 subjects were in that particular group, the median split procedure distributed the seniors into 2 groups of 15).

Authoritative, Authoritarian, Permissive and Neglectful parenting styles were created using a median split procedure of the monitoring and nurturance subscales of the Parenting Practices Scale.

To analyse associations between SEP and cancer awareness of symptoms and risk factors, cancer awareness was categorised into low/high using the median split procedure.