Sentence examples for split constructs from inspiring English sources

The constructs were used to generate two populations of stable suspension HeLa (sHeLa) cell lines, each expressing one of the split constructs.

Cys residues can be engineered into split receptor constructs.

Furthermore, we report that split marker constructs were equally efficient for targeted gene disruptions using the T. gondii UPRT gene locus as a test case.

We thank Diane Lipscombe for supplying the rat α12.2 clone, Henry Colecraft for supplying the human β2a clone, Tsutomu Tanabe for supplying the rabbit α2δ1 clone, Catherine Berlot for supplying the split CFP constructs, and Roger Tsien for mCherry (via Addgene).

Constructing a join tree and a split tree, Constructing an augmented contour tree, Composing a final contour tree.

Furthermore, if the same total amount of split-GFP constructs relative to intact Q73 GFP is expressed, then the maximal possible split-GFP fluorescence signal is only 50% of intact GFP.

Split-GFP constructs were based on the plasmids designed by (Barnard et al, 2008), with the split-GFP fragments introduced behind the GAL1 promoter into centromeric plasmids to generate a conditional split-GFP system (Munck et al, 2009).

Split-GFP constructs were generated by PCR using pEGFP-N1 as a template with the following primers: Split-GFP 1 157 was amplified using the forward primer GCAAATGGGCGGTAGGCG reverse primer GATCGCGGCCGCTTACTGCTTGTCGGCCATG and subcloned into Age1 and Not1 of SFpEGFP-N1.

With the split-GFP constructs, two trends immediately stand out.

This assumes all of the split-GFP constructs interact to form fluorophores.

Split-GFP constructs revealed the capacity of all of the constructs to form oligomers of at least two mHttex1 molecules.