Study Design: Two lateral flow rapid HIV antibody assays, SeroStrip HIV-1/21 and Determine HIV-1/2, were evaluated for their ability to detect HIV-1 antibodies in serum and/or plasma specimens pooled in sizes ranging from two to 20 following the respective manufacturers' protocols.
Total RNA of 10 larval specimens (pooled) of Zorotypus gurneyi?
In addition, a strong linear correlation (r = 0.789, slope = -0.17, P <0.001, n =20; Figure 6D) between CA and the SI was detected after analysis of the femoral head specimens pooled across ages in model group.
We tested nasal pharyngeal swab specimens (pooled) from all 43 infants (100%<122 months of age) living in the outbreak orphanage and nasal swab specimens from the 40 youngest children (97.5% <12 months of age) at the control orphanage within 2 weeks of the outbreak.
Finally, the SSHN gene expression classifier was further validated at the protein level in yet another in-house, independent set of formalin fixed paraffin embedded patient tissue samples analyzed by shotgun proteomics and comprised of 5 samples each of SCLC, SCC, ADC and age- and smoking history-matched normal lung tissues specimens, pooled by histologic type.
To verify the field species identification, we took a proportion of the homogenates from each specimen or specimen pool for genomic DNA extraction using E.Z.N.A. DNA/RNA Isolation Kit (OMEGA).
Objectives: To develop a strategic specimen pooling method to be used with rapid HIV antibody assays to detect positive specimens and to evaluate its performance in comparison with testing with commercial EIA and WB.
Following microbial cell lysis, DNA was extracted from three aliquots of each fecal specimen, pooled, and used to amplify V2 region 16S rRNA genes using primers FWD: AGAGTTTGATCCTGGCTCAG and REV: TGCTGCCTCCCGTAGGAGT (Turnbaugh et al, 2009).
Here, we assessed what kind of genomic information can be extracted from low-coverage metagenome sequencing of two specimen pools that were originally generated to address questions about taxonomic (Gillett et al. 2014) and ecological diversity (Crampton-Platt et al. 2015).
The results demonstrate that MGS of insect specimen pools extracts data relevant for phylogenomics, ecology or simply to explore the black box of arthropod genome evolution through their multicopy and most conserved elements.
