Exact(1)
To verify the field species identification, we took a proportion of the homogenates from each specimen or specimen pool for genomic DNA extraction using E.Z.N.A. DNA/RNA Isolation Kit (OMEGA).
Similar(59)
Objectives: To develop a strategic specimen pooling method to be used with rapid HIV antibody assays to detect positive specimens and to evaluate its performance in comparison with testing with commercial EIA and WB.
Following microbial cell lysis, DNA was extracted from three aliquots of each fecal specimen, pooled, and used to amplify V2 region 16S rRNA genes using primers FWD: AGAGTTTGATCCTGGCTCAG and REV: TGCTGCCTCCCGTAGGAGT (Turnbaugh et al, 2009).
Here, we assessed what kind of genomic information can be extracted from low-coverage metagenome sequencing of two specimen pools that were originally generated to address questions about taxonomic (Gillett et al. 2014) and ecological diversity (Crampton-Platt et al. 2015).
The results demonstrate that MGS of insect specimen pools extracts data relevant for phylogenomics, ecology or simply to explore the black box of arthropod genome evolution through their multicopy and most conserved elements.
The implementation of pooled NAAT for HIV detection has been shown to increase the diagnostic yield of HIV testing algorithms by 0.1 23%, depending on the population tested, the generation of screening EIA test used [16], and the specimen pooling schemes utilized [17].
From the proteomic analysis of 6 hippocampal tissue specimens (pool of 3 AD and pool of 3 controls), 2954 proteins were identified, with at least two peptides for 1203 of them.
Study Design: Two lateral flow rapid HIV antibody assays, SeroStrip HIV-1/21 and Determine HIV-1/2, were evaluated for their ability to detect HIV-1 antibodies in serum and/or plasma specimens pooled in sizes ranging from two to 20 following the respective manufacturers' protocols.
Total RNA of 10 larval specimens (pooled) of Zorotypus gurneyi?
In addition, a strong linear correlation (r = 0.789, slope = -0.17, P <0.001, n =20; Figure 6D) between CA and the SI was detected after analysis of the femoral head specimens pooled across ages in model group.
We tested nasal pharyngeal swab specimens (pooled) from all 43 infants (100%<122 months of age) living in the outbreak orphanage and nasal swab specimens from the 40 youngest children (97.5% <12 months of age) at the control orphanage within 2 weeks of the outbreak.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com