Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
This result is consistent in the framework of photon diffusion theory, where at least one transport MFP is required between the location of the emitted photon and the forward boundary of the specimen for efficient multiple scattering to occur[ 38].
Similar(59)
One of the difficulties comes from preparation of vitrified specimen that is suitable for efficient data collection and high-resolution image processing.
Future laboratory related work should ensure a system for efficient specimen handling, regular supply of markers, and participation in quality assurance to ensure that the CPHRL is advanced to the list of National Influenza Center status.
A simple protein extraction protocol was established, using a bead mill for homogenizing fly specimens and the denaturing conditions of 6 M urea for efficient solubilization of proteins.
Specific primers for the PIK3CA gene exons 9 and 20 (PIK-E9F: CCAGAGGGGAAAAATATGACA; PIK-E9R: CATTTTAGCACTTACCTGTGAC; PIK-E20F: CATTTGCTCCAAACTGACCA; PIK-E20R: GGTCTTTGCCTGCTGAGAGT) were designed for efficient PCR amplification from paraffin-embedded specimens.
This was necessary for efficient extraction of Staphylococcus aureus DNA from sputum specimens, as we had previously found that mock specimens containing Staphylococcus aureus spikes were underquantified with standard automated extraction only.
Flat specimen tests are performed to determine calibration parameters and are used for efficient re-parameterization of a transversally isotropic material card used in finite element (FE) simulation.
Surgical skin specimens provided herein epidermal keratinocytes used as the somatic source for efficient and rapid iPS derivation.
The duplex real-time RT-PCR assay described in the present study can therefore be applied for efficient identification of hMPV and hRSV in clinical specimens and collection of information on the epidemiology and clinical outcome of these viruses.
Thus, there is a strong need for new culture techniques to allow for efficient detection of B. pseudomallei in fecal and other specimens.
This does not make for efficient policing.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com