Sentence examples for specifications both for from inspiring English sources

Then, a large section deals with degrees of freedom analysis, an important topic in ensuring adequate specifications both for the simulation units and for the whole flowsheet.

In the control design the changes in the forward velocity, the performance specifications both for rollover and suspension problems, and the model uncertainties are taken into consideration.

For both specifications, both the primary and secondary peaks were observable, but the intensity trough between the peaks in the 3.1 μm case was shallower as the spacing between the bright particle monolayers approached the theoretical axial resolution for the optical imaging system.

Table 8 gives the results for each of our five specifications, both overall and for each quartile of the academic index30.

Meanwhile, the RAF explored ways of compensating for the lower yield by including, in the specifications for both the bomb and TSR-2, provision for releasing the smaller weapons in salvos, dropping sticks of four of the revised OR.1177, later named WE.177A, at 1000 yards intervals to prevent the detonation of the first weapon destroying the succeeding ones before they could, in turn, detonate.

SAS PROC MIXED was used for both analyses given the linear mixed model specifications for both experiments [ 23].

These reconstruction settings should thus be chosen to meet the multicentre QC harmonising specifications for both calibration QC and image quality/SUV recovery QC, for example as described on the EARL website [ 46].

Modified primers for the psbJ-petA region in A. germinans were F: AGATTGATCGATATCGGGTTC and R: GGAAAACCGAAACCCAGAC. Modified primers for R. mangle analysis, PCR and sequencing specifications for both species were described previously [ 13].