Sentence examples for specifically common from inspiring English sources

In my most recent blog, I talked about different small business structures and some of the tax implications for each, this week I will go over tax considerations, specifically, common deductions available for your small business.

Most GPs appreciated their mental healthcare practice (specifically common mental disorders) and viewed it as a source of satisfaction.

The results are supportive of the 'infectious' aetiology hypothesis for subsets of childhood leukaemia, specifically common ALL in the childhood peak.

Genotyping used primers and PCR conditions suggested by Jackson Labs, specifically the common primer 5′GCCCTGCCTTTCCCACCATA3 ′, the mutant-specific primer 5′TTGCAGCACATCCCCCTTTC3 ′ generating a 450 bp amplicon and the wild type specific primer 5′ATCAACTTTGGGAGCCACAC3′ generating a 350 bp amplicon.

I don't buy "outrageous," but "distortion" works for me -- specifically, the common newspaper crime of distortion by abbreviation.

Basic grammar books have existed since the 16th century, but it wasn't until the 18th that guides like Robert Baker's "Reflections on the English Language" (1770) and James Elphinston's charmingly titled "Inglish Orthoggraphy, Epittomized" (1790) began specifically addressing common mistakes of usage.

These answers stated that organism A and B were "related" or "had similar traits" without specifically mentioning common descent.

Specifically, a common frontoparietal delta and a central alpha process corresponded to rule implementation and motor response respectively.

Finally, an individual organization describes its CDS infrastructure, process of prioritization, design, and development, with selected highlights of CDS tools specifically targeting common infection prevention quality improvement initiatives.

We then transformed the module into a "tutorial" format, with all instructions onscreen, along with multiple-choice and other forced-response assessments that provide immediate feedback, enabling the material to more specifically address common misconceptions and reinforce key concepts (we refer to this as the tutorial version).

Specifically, students' common difficulties are: students' met-before (previous experience), selecting appropriate representation of the three worlds of mathematical thinking, the transition from one world to another world of mathematical thinking, lack of understanding two different embodiments, and lack of understanding two different symbolic for a concept.