Your English writing platform
Discover LudwigExact(10)
In [5], specific tandem and joint source-channel coding strategies with complexity and delay constraints were analyzed and compared.
These families arose, expanded, and diversified via whole genome duplications (polyploidy), which are common in many plant lineages, more restricted segmental duplications, highly specific tandem duplications and transposon-mediated events, and even exon shuffling among individual genes [7], [8], [9], [10], [11].
They are all placed close together in the same contig and may correspond to specific tandem duplications in this species.
Also apparent from the TRF output are 16 large arrays that consist of locus specific tandem repeats, ranging in repeat size from 20 bp up to 1823 bp.
There are several examples of specific tandem arrangements such as resa, R45-like, eba (see Figure 4), suggesting an ancient higher order organisation.
To characterize the molecular organization and the abundance of the specific tandem repeats observed by fluorescence in situ hybridization, southern blot was conducted to further analyze the genomic organization of them in Cucumis species.
Similar(50)
Figure 2 Inter-instrument comparability of dixyrazine-specific tandem mass spectra collected on different instrumental platforms.
It will be interesting to explore the genomic organization of SCRiP loci to examine whether lineage-specific tandem duplications may have occurred in M. faveolata.
To stably induce expression of short hairpins in cells, the CTMP-specific tandem sequences 5'-GATCCCAAGACCCTATACTCAGA GGCGTTCandAGACGCCTCTGAGTAGGGTCTTTTTGGAAA-3' AGCTTTT AGCCAAAAAGACCCTACTCAGAGGCGTCTCTTGAACGCCTCTGAGTCTGATGGGTGGG TCGG-3' were cloned in the BglII/HindIII sites of pTer vector [44].
The major exceptions are approximately two dozen mammal- or tetrapod-specific tandem duplication-derived trace amine receptors (subclass A2), chemokine receptors (subclass A7), MAS-related family receptors (subclass A8), and the origins of these nGPCRs remain to be determined (Table S2 C) [33], [34], [35].
83 genes were species-specific tandem duplicated genes in B. rapa genome.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com