Sentence examples for spanning part of from inspiring English sources

The fragment characterizing the A⁎ allele (A⁎ refers to the αs1-casein alleles bearing an intact 19th exon) was 583 bp long, and the fragment characterizing the E allele was 437 bp long, spanning part of the 18th intron, part of the 19th exon and 146 bp of the LINE inserted sequence.

A third construct which was generated by cloning a 913 bp amplicon spanning part of the fkh ORF and part of the fkh 3'-UTR into the Sym-pUAST-w vector [42] was found to be less effective in inducing in vivo knockdown compared to the other two constructs (data not shown), and was therefore not further used in most experiments.

An area spanning part of the mitochondrial Cytochrome Oxidase I and II genes was amplified under standard PCR conditions using primers mt2793+ (5'ATACCTCGACGTTATTATTCAGA) and mt3660- (5'CCACAAATTTCTGAACATTGACCA).

When compared to SCR, the sequence of the same region in SCR+ encodes a single putative heptad repeat spanning part of the octapeptide and the LASCY motifs.

Truncated nesting is annotated only if there is no sequence missing from the the interrupting terminus of the interrupting element (so that a deletion spanning part of the truncated element and part of the interrupting element is not considered).

Internal sequencing primers were used directly on PCR products to generate chromatograms, spanning part of exon 2 and all of exon 3, at Molecular Cloning Laboratories (McLab, San Francisco, CA) (see Additional file 2: Table S3 of primer sequences).

An L.TU exon would be the very last in a gene and it may span part-of or the entire translated region.

They have rebelled against the government several times, and, together with Toubou tribesmen, they have hoped to establish an independent Saharan state, spanning parts of Mali, Niger, Algeria, Chad, and Libya.

The study combined climate, social and economic data relating to the so-called Fertile Crescent, spanning parts of Turkey and much of Syria and Iraq, where agriculture and herding are thought to have started 12,000 years ago and continue to be crucial.

Meanwhile, in a Senate district spanning parts of Westchester and the Bronx, Republican voters seemed to be rebelling against a common Albany mentality that holds that the only difference between political parties is the lobbyists who form their most dedicated cadre of campaign contributors.

A three-dimensional model of the membrane spanning parts of the transporter was constructed.