Sentence examples for spacers according to from inspiring English sources

They used a monoblock head spacer of uniform diameter of 50 mm, while we used variable sizes of spacers according to the retrieved cup size.

To group spacers according to their trinucleotide content, we first compiled the trinucleotide content for all spacers and added them to a database.

Lung function: (hypothesis 1) Spirometric function was measured before and 10 minutes after the administration of 200 μg sulbutamol via large volume spacer, according to standard methods.

The history of encounters with SV1-related phages was determined for six strains per species (three harboring and three lacking SV1) by analyzing the location of matching spacers within spacer arrays according to the concept that ancestral spacers are commonly located at the 'trailer' end and more recent spacers at the 'leader' end of a spacer array [ 4].

In addition to subject-specificity, CRISPR spacers vary according to biogeographic sites sampled [ 28, 34].

In this queuing model, customers (i.e., spacers) arrive according to a Poisson process with rate λ.

We normalized spacer values according to their Percentage Per Thousand Spacers (PPTS) so that we could directly compare their proportions across DNA and cDNA.

To assemble CRISPR loci, we binned all spacer sequences according to their trinucleotide content.

We binned the spacer sequences according to our previously described protocols based on their trinucleotide content to correct for potential sequencing errors as well as to group highly similar spacer sequences [ 29].

Spacers are colored according to sequence similarity.

Individual spacers were removed from the sequences by manually extracting the sequence between the repeats sequences: A repeat is GATAATCTACTATAGAATTGAAAG and C repeat is GATTAATCCTAAAAGGAATTGAAAG. Spacers were grouped according to the ends of the loci they came from, and BLASTn [48] with E<0.001 was used to find 100% spacer matches.