Your English writing platform
Discover LudwigSimilar(60)
Immunoglobulin κ cDNA was amplified with 30 cycles at 62°C annealing temperature using the following primers: Vκ deg F: GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC; Cκ R: GTCCTGATCAGTCCAACTGTTCAG; Bone marrow pre-BI, large and small pre-BII and immature B cells were isolated by cell sorting and fixed in 1% paraformaldehyde at 4°C overnight.
Primary cells were sorted, irradiated and fixed at 30 min post irradiation.
We lose our ability to sort things out and fix them in their proper places.
These could be as simple as making, sorting, or fixing things.
He nodded furiously, making some sort of fixing motion in the air with his fingers.
In the past, any sort of fixing in the game has been desperately hard to nail.
This time I was still in town, having a drink with Jonathan Agnew on Saturday night when we heard rumours of some sort of fixing scandal.
"I knew you'd be late," he said, "so I thought I'd save us all the trouble of bringing the lottery to a halt while we tear the town apart so you can get your caffeine fix—" "It is a fix, you fixer, you, you have fixed me, thank you, you wonderful fixing man, like some sort of fixing machine," Lorelai said.
"They're the ones who detected the Arizona State scandal back in '94....Any sort of fixing is not good for their business, either.
We have described the novel combination of cell fixation, cell sorting and chromatin immunoprecipitation (Fix-Sort-ChIP assay) as a means of following the localization of transcription factors, in this case c-Myb, during different phases of the cell cycle.
MSCs derived osteoblasts, osteoclasts, mineralized bone matrix, and some sort of fixed osteocytes within bone are the major components of bone microenvironment.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com