Sentence examples for solution solution from inspiring English sources

Exact(36)

Solution Rick Quino came in early with this solution: Solution for 7 rectangles: Layout ABCC ABDE AFFE GGGE Sizes (rounded to 2 decimal places) horizontal x vertical A: 2.60 x 12.36 B: 3.57 x 9.00 C: 8.83 x 3.64 D: 6.00 x 5.36 E: 2.83 x 11.36 F: 9.57 x 3.36 G: 12.17 x 2.64 Trying to prove there is no 6 rectangle solution.

Electrohydrodynamic (EHD) co-casting Eu-containing shell solution (Solution I) and Fe-containing core solution (Solution II) was performed by using the coaxial needle.

After stirring at 60 °C for 30 min, the first solution, Solution I was obtained.

Variables studied were N2 superficial velocity, physical properties of the solution, solution velocity and inlet nozzle diameter (dn).

Variables studied were helical tube diameter, physical properties of the solution, solution velocity and superficial gas velocity.

For comparison, electrohydrodynamic (EHD) co-casting of Fe-containing shell solution (Solution II) and Eu-containing core solution (Solution I) was also performed using the same-sized coaxial needle, which generates long and uniform fibers as well.

Show more...

Similar(24)

The 60-mer containing the ETS↔CRE motif on the ETS-CRE array has the ETS motif toward the solution (solution-GTCCTCAAGA C/ GCGGAAGTGACGTCACGACTCAGGTG|GGACACACTTTAACACATGGAGAG-slide).

TGE may be performed in solution (solution-based targeted genomic enrichment, solution-based TGE, [ 5]), or on an array platform (solid-phase targeted genomic enrichment, solid-phase TGE, [ 6]).

In the first step, two different solutions, solution I and solution II, were prepared separately.

After incubation, each mixture was added to 5 μl reverse transcription solution (2 μl 5X first strand buffer, 1 μl DTT at 20 mM, 1 μl dNTPs at 10 mM each, and 1 μl mint reverse transcriptase), incubated at 42°C for 30 min, and then incubated with IP-solution (solution for incorporation of the PlugOligo sequence) for 1.5 hr at 42°C.

The assay was comprised of three solutions; solution 1, solution 2 and the lipase solution.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: