Sentence examples for small neighboring from inspiring English sources

Small neighboring villages that shared common ethnic and kin ties were grouped together to form a single cluster.

It was actually made in Navarre, but for bureaucratic reasons carries the name of a small neighboring appellation.

The program, which is paid for with private money, buses nearly all pregnant blacks in Sharkey and a small neighboring county to pre- and postnatal classes.

A small neighboring property — only accessible by boat or via an easement through the Musgrave House grounds — also has come on the market.

By the time he landed on this small neighboring island in the English Channel, the exiled writer was in desperate need of asylum.

For decades, the four small neighboring towns here -- Zipolite, San Agustinillo, Mazunte and Ventanilla -- were nearly empty except for fishermen hunting sea turtles or harvesting their eggs.

But a smaller, neighboring sect decided to support the Republican candidate, George Pataki.

A smaller, neighboring glacier, the Smith glacier, is losing mass even more quickly, he said.

The two smaller, neighboring 18S regions were annealed at 53°C [primer F19 [ 57] and 500R (5'CCGACTCATTTCGATCGTCGCGCCGC3')] or 56°C [primer 2000F (5'CGAACCCCGCGCGTGCTCGG3')/R1843 [ 56]].

Search for imperfect segmental duplications revealed larger duplicons, suggesting that some smaller neighboring perfect duplicons can merge to form larger imperfect ones.

A per-atom test will essentially ignore correlated motions (even if small) between neighboring atoms; in contrast, a whole-model test will be able to identify even small correlated motions.