Sentence examples for size of fragment from inspiring English sources

It has been known that the barrier effect of cellular (fragment) sub-boundaries on the growth of martensitic crystal is always weaker than that of grain boundaries and can be determined from the size of fragment and the misorientation angle between neighboring fragments [7].

Primers for each gene and size of fragment are shown in Table S4.

Interferon-gamma (IFN-γ) forward 5'-TGGAGGAACTGGCAAAAGGATG -3', and reverse 5'-CGCTTCCTGAGGCTGGATTC -3', with size of fragment as 289 bp.

Tumor necrosis factor-alpha (TNF-α) forward 5'- CCTGTAGCCCACGTCGTAGC -3' and reverse, 5'- TTGACCTCAGCGCTGAGTTG -3' with size of fragment as 373 bp.

Interleukin 23 receptor (IL-23R) forward, 5'-TCCACTGACTCACTGCAAGG -3' and reverse 5'-GTTCGTGGGATGATTTTGCT -3', with size of fragment as 500 bp.

We chose the 300 bp minimum because many recognizable protein domains are in this size range; in addition, this size of fragment works well in yeast two-hybrid assays.

Cross-sectional SEM pictures show a decreasing size of fragments with increasing YPP.

Therefore, the size of fragments amplified from A. carbonarius was between 900 and 1000 bp.

After 80 to 100 cycles, the size of fragments reached the nanoscale level (about 100 nm).

These primer pairs amplified expected size of fragments in five congeneric tuna species, and utility of these primer pairs was investigated using distant fish species.

The uniformity index was n = 0.79 and the mean size of fragments (S50 = 37.5 cm) showed the high percentage of boulders in the rock mass.