Sentence examples for sites upper from inspiring English sources

The order of body sites (upper arm vs. thigh vs. lower leg) and channel segment (meridian vs. control) were randomized.

The observed difference in the size of ceQORH (Figure 3A) and AtHMA1 (Figure 3B) confirmed the presence/absence of the attB sites (upper and lower bands, respectively).

The nucleotide sequences of the ZFN-binding sites (upper case) and nonspecific cut site for wild-type heterodimeric Fok1 endonuclease (lower case) are: AaegTRPA1: 5'-GTCGTTTTCGTCCATACCgatgtcGTTGCTTAGGACGTT-3'.

2 Three millimeter punch biopsies were performed on four body sites: upper arm (hyperhidrotic area) and thigh, leg, and fingertip (anhidrotic areas).

7 This tool is used to evaluate hair growth at seven sites: upper lip, chin/face, chest, back, abdomen, arms, and thighs.

RPFNA was performed to obtain breast epithelial cells under local anesthesia from two sites (upper outer and upper inner quadrant) and cells were pooled from both breasts [ 1].

Figure 1 Medial meniscus tear and meniscus repair in a right knee joint: Meniscus tear recognized by a probe (upper left); Meniscus tear preparation with a grasp, which refreshes the tear site (upper right); Meniscus suture with all inside technique (Fast T Fix, Smith nephew) (lower left); Stable meniscus tear after repair (lower right).

Although some portions of the model (center right) are more detailed than others (lower right), researchers are able to virtually stroll through the site (upper right) and study it as if it still exists in its original form, the team suggests online today in PLOS ONE.

Application of the tetanic pulse train to this electrode resulted both enhancement and depression of spike rate activity whose direction was dependent on the stimulus location producing increased spike rates near the tetanic site (upper left near tetantic site) and decreases toward distant electrodes and was seen in all subjects.

The following primers were used for amplifying itga6; FP: gttctttttgcaggatcccat atcgatATGGAGCTCTTTGAGAAAGCGC (lower case— pCS2 sequence, bold ClaI site, upper case— itga6 sequence) RP: GAGAGGCCTTGAATTCGA atcgattgagtagctctcgttctcatcccac (lower case— pCS2 sequence, bold ClaI site, upper case— itga6 sequence).

Halocline samples are designated in the following descending order by their relative location (based on refractometer reading, visible siting): upper halocline, mid-halocline, and lower halocline.