Sentence examples for sites for restriction from inspiring English sources

The italic bases are recognition sites for restriction endonuclease enzymes.

Additional input parameters included potential cleavage sites for restriction endonucleases or proteases to avoid such that the selected linkers would be resistant against the restriction enzymes and the specified protease during the DNA cloning and protein purification process, respectively.

There sulting vectors have 2A sequences flanked by several unique recognition sites for restriction endonucleases (Fig. 1C).

The following primers introduced XhoI and BamHI site, respectively, in the PCR product: 5'-GGAGATCTCGAGATGGATCAGAACAAC-3'and 5'-GCAGCCGGATCCCGTCGTCTTCCT-3' Underlined sequences in the primers mentioned above represent the sites for restriction endonucleases.

In addition, these primers also contain 15 20 nucleotide common sequences that contain sites for restriction enzymes for cloning of the PCR products into the YTH screen vectors (pGADT7 and pGBKT7) and the mammalian expression vectors (pCMV-HA and pCMV-Myc) (Supporting Information Table S1).

Sites for restriction endonucleases are indicated in bold or italic.

To facilitate the separation of the two complementary strands, we introduced a recognition site for restriction enzyme Hpy99I into the probe positioned between the tandem repeats and downstream to the recognition site for PspGI.

The consensus sequence of OwlAlp1 carried a recognition site for restriction enzyme NdeI (CATATG), whereas that of OwlAlp2 did not.

The mutation is in the following sequence: GCAAGTTTACCAATCTTCCC G CTGGGTTCCAGTTATCAAGG. As this mutation creates an additional site for restriction endonuclease digestion using TspRI, the mutation was rechecked by TspRI digestion of the PCR product.

The promoter fragments were amplified by PCR using primers provided with restriction sites for the restriction enzymes SmaI and XbaI allowing ligation into the SmaI / XbaI sites of pKKlux.

This plasmid was then modified to contain restriction endonuclease sites for standard restriction endonuclease based cloning approaches or two SapI (type IIS) restriction endonuclease sites that are useful for a new, rapid, directional cloning strategy.